Pedigree ID | # Affected members | Gender | Age at recruitment | Case ID | lrWGS Dx | Parental Consanguinity | Gene | Variant | Zygosity |
---|---|---|---|---|---|---|---|---|---|
F4386 | 3 | M | 16Â days | 14DG1582 | TYMS-related lactic acidosis | First cousins | TYMS | NM_001071.4:c.455-2073ins of 270Â bp | Homozygous |
F6404 | 2 | F | 2 weeks | 20DG0785 | ANO7 and STK25-related neurodevelopmental disorder | First cousins | STK25 | NM_001370694.2:c.2178 + 83del of 184 bp (in ANO7) | Homozygous |
F3981 | 3 | F | 5Â months | 17DG1097 | Retinitis pigmentosa 88 | Non-consanguineous | RP1L1 | NM_178857.6:c.4026_4027insACAGA AGAAGGGCTGCAAGAAGAGGGGGTGC AGTTAGAGGAAACTAAAACAGAAGAAG GGCTGCAAGAAGAGGGGGTGCAGTTA GAGGAAACTAAAACAGAAGAAGGGCT GCAAGAAGAGGGGGTGCAGTTAGAGG GGACTAAA;p.Glu1343delinsThrGluGlu GlyLeuGlnGluGluGlyValGlnLeuGluGlu ThrLysThrGluGluGlyLeuGlnGluGluGlyV alGlnLeuGluGluThrLysThrGluGluGlyLe uGlnGluGluGlyValGlnLeuGluGlyThrLys Glu and NM_178857.6:c.3970_3971insGGACT AAAGTAATAGAAGGGCTGCAAGAAGA GAGGGTGCAGTTAGAGG;p.Glu1324del insGlyThrLysValIleGluGlyLeuGlnGluGl uArgValGlnLeuGluGlu | Compound heterozygous |
F7974 | 2 | F | 10 years | 20DG0235 | SLC4A4-related band keratopathy | First cousins | SLC4A4 | NM_001134742.2:c.-145C > T | Homozygous |
F4591 | 4 | M | 2 years | 14DG2098 | SNAP91-related microcephalic primordial dwarfism | First cousins | SNAP91 | NM_001242792.1:c.766-4799T > C | Homozygous |
F5927 | 4 | F | 7Â months | 17DG0832 | LEMD2-related neurodevelopmental disorder | Same tribe | LEMD2 | NM_181336.4:c.1011-469_1011- 450del | Homozygous |