Skip to main content

Table 2 Summary of primers for fungal rDNA amplification used in mycobiome studies

From: The human mycobiome in health and disease

Amplicon Primer sets Primer sequence Length* Citation
ITS ITS1 ITS1F/
ITS2
CTTGGTCATTTAGAGGAAGTAA 260 bp [8, 31]
    GCTGCGTTCTTCATCGATGC   
  ITS2 3271-ITS2F/
3271-ITS2R
CARCAAYGGATCTCTTGG 340-360 bp [19]
    GATATGCTTAAGTTCAGCGGGT   
  ITS1-5.8S-ITS2 ITS1F/
ITS4
CTTGGTCATTTAGAGGAAGTAA 550 bp [65]
    TCCTCCGCTTATTGATATGC   
LSU LROR_F/
LR5-F
CCGCTGAACTTAAGCATATCAATA 860 bp [65]
   CGATCGATTTGCACGTCAGA   
  NL1/
NL4
GCATATCAATAAGCGGAGGAAAAG 600 bp [66]
   GGTCCGTGTTTCAAGACGG   
SSU 18S_0067a_deg/NSR 399 AAGCCATGCATGYCTAAGTATMA 350 bp [21]
   TCTCAGGCTCCYTCTCCGG