Figure 2From: Copy number variations and cancerCancer CNV breakpoint mapping. We mapped a 1.1 kb deletion in the mitochondrial tumor suppressor gene, MTUS1, to base-pair resolution. The affected portion of the gene is shown, including an exon (blue) that is deleted in the presence of the CNV. Two 41 bp repeats (with sequence AAATAAGAACCAAGTCCAAATACATCTTTGGAATGAAAGAG) were found at the breakpoints (red), while the sequence of the junction fragment is shown in the chromatogram.Back to article page