Skip to main content

Table 2 Primer sequences

From: Activation of an endogenous retrovirus-associated long non-coding RNA in human adenocarcinoma

Oligo Purpose Sequence (5′-3′)
oHL_0005 Forward RT-PCR primers for EVADR transcript TGATGCCATTTTCAGCCTCAG
oHL_0006 Reverse RT-PCR primers for EVADR transcript TGGCCGCTCAGATTCTCTATC
oHL_0011 Clone MER48 LTR upstream of EVADR. XhoI/HindIII GGCTCGAGTAAGGGAATGAATAACTCCG
oHL_0012 Clone MER48 LTR upstream of EVADR. XhoI/HindIII GGCTCGAGATATGTACCCTGTGAAGACC
oHL_0015 Cloning small fragment of MER48 element GGCTCGAGGTGCTGATGCCATTTTCAGCC
oHL_0013 Clone MER48 LTR upstream of EVADR. XhoI/HindIII GGAACCTTACATGCTGTTTTAATGAGCG
oHL_0016 Same as oHL_0011 but reversed restriction site. XhoI CCAAGGTTTAAGGGAATGAATAACTCCG
oHL_0017 Same as oHL_0012 but reversed restriction site. HindIII GGCTCGAGACATGCTGTTTTAATGAGCG
oHL_0014 Same primer as oHL_0006 but for cloning 5′RACE products CCGGATCCTGGCCGCTCAGATTCTCTATC