Skip to main content

Table 1 Primer sequences and coordinates

From: Novel APC promoter and exon 1B deletion and allelic silencing in three mutation-negative classic familial adenomatous polyposis families

Primer name Primer sequence Left-most position of primer
(GRCh37/hg19 coordinates)
P2 5′ GAGGCCAGTATTACTTTGATACCC 3′ chr5:112,034,958
P3 5′ CTGACCAATATCCTCACATAGCTG 3′ chr5:112,045,903
P4 5′ GAGTTCCCTGGTGTAAATGCTCT 3′ chr5:112,032,220
P5 5′ CCCTAACAACCAGTCTGAGTAGC 3′ chr5:112,032,727
P6 5′ AGTAAACCTGGAAAGAGCACCAC 3′ chr5:112,032,926
P8 5′ ATCCTCCATATCTGTGGGTTCTG 3′ chr5:112,034,220
P9 5′ GCTCTGCTTAACGACAGGAATAC 3′ chr5:112,034,692
P10 5′ GTAGAGGCCAGATACACTAATGTCC 3′ chr5:112,049,943
P12 5′ CCAGAGATCAGTAGTCTTTCCAGAG 3′ chr5:112,051,725
P13 5′ CAGAGACCTGCACTCAATAAATGG 3′ chr5:112,052,217
P14 5′ ACAGTGTCTGGCTCTCTGAGATACT 3′ chr5:112,029,655
P15 5′ CATCTATGTAGGCTAGAGAGGGAGA 3′ chr5:112,046,239
P16 5′ AGTTAGCTGCTGGAGAAGGAGTTAG 3′ chr5:112,176,294
P17 5′ GCTGGTAACTTTAGCCTCTGATTC 3′ chr5:112,176,956
P18 5′ GAATCAGAGGCTAAAGTTACCAGC 3′ chr5:112,176,956
P19 5′ GTCACTGAGAGAACTCAGAGAGGAA 3′ chr5:112,177,189