Skip to main content

Table 1 Oligonucleotide sequences used in this study

From: Pharmacological inhibition of DNA-PK stimulates Cas9-mediated genome editing

TLR donor sense ACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCATGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCG
TLR donor antisense CGGGGTAGCGGCTGAAGCACTGCACGCCGTAGGTCAGGGTGGTCACGAGGGTGGGCCATGGCACGGGCAGCTTGCCGGTGGTGCAGATGAACTTCAGGGTCAGCTTGCCGT
p53-1 sense donor CCCCAGGCCGGCTCTGAGTATACCACCATCCACTACAAGTACATGTGCAACAGTTCTTGTTGGGGGGCATGAACCGCCGACCTATCCTTACCATCATCACACTGGAAGAC
p53-1 antisense donor GTCTTCCAGTGTGATGATGGTAAGGATAGGTCGGCGGTTCATGCCCCCCAACAAGAACTGTTGCACATGTACTTGTAGTGGATGGTGGTATACTCAGAGCCGGCCTGGGG
P53-1 BarcodeIonXpress_1 CCATCTCATCCCTGCGTGTCTCCGACTCAGCTAAGGTAACGATTTCACCTGGATCCTGTGTCT
P53-1 BarcodeIonXpress_3 CCATCTCATCCCTGCGTGTCTCCGACTCAGAAGAGGATTCGATTTCACCTGGATCCTGTGTCT
P53-1 BarcodeIonXpress_4 CCATCTCATCCCTGCGTGTCTCCGACTCAGTACCAAGATCGATTTCACCTGGATCCTGTGTCT
P53-1 BarcodeIonXpress_6 CCATCTCATCCCTGCGTGTCTCCGACTCAGCTGCAAGTTCGATTTCACCTGGATCCTGTGTCT
P53-1 BarcodeIonXpress_8 CCATCTCATCCCTGCGTGTCTCCGACTCAGTTCCGATAACGATTTCACCTGGATCCTGTGTCT
P53-1 BarcodeIonXpress_10 CCATCTCATCCCTGCGTGTCTCCGACTCAGCTGACCGAACGATTTCACCTGGATCCTGTGTCT
P53-1 barcoding Reverse oligo: CCTCTCTATGGGCAGTCGGTGATGTCCCTCCAATTTTACACCT
p53-3 sense donor CCACACCTCCAGCTGGGAGCCGTGTCCGCGCCATGGCCATCTACAAAAAGTCCCAACAATGACGGAGGTCGTGAGACGCTGCCCCCACCATGAGCGCTGCTCCGATGGT
p53-3 antisense donor ACCATCGGAGCAGCGCTCATGGTGGGGGCAGCGTCTCACGACCTCCGTCATTGTTGGGACTTTTTGTAGATGGCCATGGCGCGGACACGGCTCCCAGCTGGAGGTGTGG
P53-3 BarcodeIonXpress_38 CCATCTCATCCCTGCGTGTCTCCGACTCAGTGGAGGACGGACGATACGTGCCCTGTGCAGTTGTG
P53-3 BarcodeIonXpress_39 CCATCTCATCCCTGCGTGTCTCCGACTCAGTAACAATCGGCGATACGTGCCCTGTGCAGTTGTG
P53-3 BarcodeIonXpress_40 CCATCTCATCCCTGCGTGTCTCCGACTCAGCTGACATAATCGATACGTGCCCTGTGCAGTTGTG
P53-3 BarcodeIonXpress_41 CCATCTCATCCCTGCGTGTCTCCGACTCAGTTCCACTTCGCGATACGTGCCCTGTGCAGTTGTG
P53-3 BarcodeIonXpress_42 CCATCTCATCCCTGCGTGTCTCCGACTCAGAGCACGAATCGATACGTGCCCTGTGCAGTTGTG
P53-3 BarcodeIonXpress_43 CCATCTCATCCCTGCGTGTCTCCGACTCAGCTTGACACCGCGATACGTGCCCTGTGCAGTTGTG
P53-3 barcoding Reverse oligo: CCTCTCTATGGGCAGTCGGTGATAGGGCTTACCATCACCATCG