Skip to main content

Table 2 Summary of all RT-PCR primers and PCR protocols used

From: Cell-free DNA analysis reveals POLR1D-mediated resistance to bevacizumab in colorectal cancer

GeneForward primer sequence (5′ → 3′)Reverse primer sequence (5′ → 3′)PCR protocolCycles
FLT3TTTCACAGGACTTGGACAGAGATTTGAGTCCGGGTGTATCTGAACTTCT95 °C/50 °C/72 °C40
VIMGAACTTTGCCGTTGAAGCTGTCTCAATGTCAAGGGCCATC95 °C/56 °C/73 °C40
CDH1GTCAGGTGCCTGAGAACGGCCATCGTTGTTCACTGG95 °C/56 °C/73 °C40
POLR1D (V1)CCACCTGAGGATCCAGAAACCCTCGTGCAATACAAATGTCA95 °C/60 °C40
POLR1D (V2)AAGAACTGCTTAAGGAGGCAATCTTCGCTGGTTCCTTATCG95 °C/60 °C40
PAN3TTGGTGCCCTCAACATCTCTTTGATCCCATCGGAACTAGC95 °C/60 °C40
CDX2GAACCTGTGCGAGTGGATGTCCTCCGGATGGTGATGTAG95 °C/60 °C40
PDX1CCTTTCCCATGGATGAAGTCTTCAACATGACAGCCAGCTC95 °C/60 °C40
LNX2ATGCAACGTTGTGATCTGGACCAAACAGTCTGCTTCTGGA95 °C/60 °C40
GAPDHCCAAAATCAAGTGGGGCGATGAAAGGTGGAGGAGTGGGTGTCG95 °C/60 °C40