Skip to main content

Table 2 Summary of all RT-PCR primers and PCR protocols used

From: Cell-free DNA analysis reveals POLR1D-mediated resistance to bevacizumab in colorectal cancer

Gene Forward primer sequence (5′ → 3′) Reverse primer sequence (5′ → 3′) PCR protocol Cycles
FLT3 TTTCACAGGACTTGGACAGAGATTT GAGTCCGGGTGTATCTGAACTTCT 95 °C/50 °C/72 °C 40
VIM GAACTTTGCCGTTGAAGCTG TCTCAATGTCAAGGGCCATC 95 °C/56 °C/73 °C 40
CDH1 GTCAGGTGCCTGAGAACG GCCATCGTTGTTCACTGG 95 °C/56 °C/73 °C 40
POLR1D (V1) CCACCTGAGGATCCAGAAAC CCTCGTGCAATACAAATGTCA 95 °C/60 °C 40
POLR1D (V2) AAGAACTGCTTAAGGAGGCAA TCTTCGCTGGTTCCTTATCG 95 °C/60 °C 40
PAN3 TTGGTGCCCTCAACATCTCT TTGATCCCATCGGAACTAGC 95 °C/60 °C 40
CDX2 GAACCTGTGCGAGTGGATG TCCTCCGGATGGTGATGTAG 95 °C/60 °C 40
PDX1 CCTTTCCCATGGATGAAGTC TTCAACATGACAGCCAGCTC 95 °C/60 °C 40
LNX2 ATGCAACGTTGTGATCTGGA CCAAACAGTCTGCTTCTGGA 95 °C/60 °C 40
GAPDH CCAAAATCAAGTGGGGCGATG AAAGGTGGAGGAGTGGGTGTCG 95 °C/60 °C 40