Skip to main content

Table 1 Identification of unique k-mers from viral assemblies

From: Profiling SARS-CoV-2 mutation fingerprints that range from the viral pangenome to individual infection quasispecies

Unique 25-mers found among the SARS-CoV-23,968 genomes: 0 present, 1 = absent AATGTATAGGGTCAGCACAAAAAAT AGATAATAGATGGTAGAATGTAAAA AGGGACTATTCCCACCCAAGAATAG TAAGACTGTATGCGGTGTGTACATA TCGTAACAATTAGTATGCCAGCAAA TGCACCAAGTGACATAGTGTAGGCA TTGGGTTCCACGTGCTAGCGCTAAC TTTCACTGCACTTTGGAAAGTAACA
England/EPI_ISL_420729 0 1 0 1 1 1 0 1
France/EPI_ISL_420038 1 1 0 1 1 1 1 1
Germany/EPI_ISL_419542 0 1 0 1 1 1 1 0
Netherlands/EPI_ISL_415482 0 1 0 1 0 1 1 1
Shanghai/EPI_ISL_416319 0 1 0 0 1 1 1 1
USA/EPI_ISL_413619 0 1 1 1 1 1 1 1
USA/EPI_ISL_420793 0 1 0 1 1 1 1 1
USA/EPI_ISL_417141 0 1 0 1 1 1 1 1
3968 SARS-CoV-2 samples 2 3968 3 3966 3958 3968 3960 3965
SARS-CoV-2100% conserved No Yes No No No Yes No No
Human genome (GRCh38) 0 0 0 0 0 0 0 1
42 influenza sequences 0 0 1 0 0 0 0 0
89 bacteria sequences 0 0 0 0 0 0 0 1
447 other human-host coronaviruses 0 0 0 10 0 0 0 0
321 other human-host viruses 0 0 1 0 0 0 0 0
SARS-CoV-2 specific Yes Yes No No Yes Yes Yes No