Skip to main content

Table 1 Scn1a 1b deletion genotyping primers

From: Deletion of a non-canonical regulatory sequence causes loss of Scn1a expression and epileptic phenotypes in mice

Primer name Sequence (5′–3′)
L_outer_Scn1a AGATCAGGCCTTCTTGCTGA
R_outer_Scn1a GGGCTCCTCATTGTTTTGGG
R_interal_Scn1a CACACACAGGCACATGATGA