Skip to main content

Table 5 sgRNA sequences for CRISPR dCas9 induction

From: Deletion of a non-canonical regulatory sequence causes loss of Scn1a expression and epileptic phenotypes in mice

Target Sequence (5′–3′) Location (hg19)
h1b_1 GCTATTTGCTGATTTGTATTAGG Chr2: 166128022 166128044
h1b_2 GAGGATACTGCAGAGGTCTCTGG Chr 2: 166984479-166984501
h1b_3 GGAAGGTTGAGAGAGGAGGGGGG Chr 2: 166984086-166984108
h1b_4 AGTATCTGCAGTATCATTGCTGG Chr 2: 166983556 166983578
h1b_5 GGAAAATTCCATGCTGAGGTTGG Chr 2: 166983037 166983059
h1b_6 TGAATGGCCACAGAGATTTACGG Chr 2: 166982669 166982691