Skip to main content

Table 1 Primers used for quantitative PCR.

From: Identification and functional validation of HPV-mediated hypermethylation in head and neck squamous cell carcinoma

Primer Direction Sequence 5'→3'
DNMT3a Forward CTGGGAGGAAGCGCAAG
  Reverse CCATTGGGTAATAGCTCTGAGG
DNMT3b Forward CCCATTCGAGTCCTGTCATTG
  Reverse TTGATATTCCCCTCGTGCTTC
DNMT1 Forward GAAGTGAAGCCCGTAGAGTG
  Reverse GGTGCTTTTCCTTGTAATCCTG
CDH8 Forward CTCTTCACCGACTTACCTACTTG
  Reverse ATGTTGAACTGCCTCTCCAG
PCDH10 Forward GACAGTGAACAGGGAGATAGTG
  Reverse TCAGAAGGGACAAAAGAAGGC